Läs källbundna sammanställningar.

2.2. Fatty Acid Composition

The main fatty acids in olive oil are oleic (18:1), linoleic (18:2), palmitic (16:0), and stearic acid (18:0). The fatty acid composition is a quality parameter and an authenticity indicator of virgin olive oils []. As shown in , oleic acid displayed the highest content that ranged between 76.60% (Koroneiki from Lesvos) and 71.92% (Kolovi from Lesvos). Linoleic acid ranged between 11.63% (Kolovi from Lesvos) and 5.71% (Koroneiki from Chania), while the corresponding values for palmitic acid ranged between 13.61% (Koroneiki from Chania) and 9.65% (Kolovi from Lesvos). The stearic acid content ranged between 2.76% (Koroneiki from Chania) and 2.20% (Kolovi from Lesvos). The fatty acids, such as palmitoleic (16:1), linolenic (18:3), arachidic (20:0), gadoleic (20:1), and behenic (22:0) acid, were detected in smaller amounts (<0.9%). The content of myristic (14:0), margaric (17:0), heptadecenoic (17:1), and lignoceric (24:0) acid did not exceed 0.1%.

2.3. Classification of EVOOs According to Cultivar

It is evident (a) that samples produced from the Koroneiki cultivar form a distinct group (green area), which is clearly separated from that of Kolovi (red area). The two Koroneiki samples that lie outside the confidence eclipse originated from Lesvos. The two principal components explain 67.7% of the total variance. Examining the loading plot (b), samples from the Kolovi cultivar are positively correlated with the content of γ-tocopherol as well as linoleic (18:2), linolenic (18:3), and gadoleic (20:1) acid. The remaining fatty acids (16:0, 16:1, 18:0, 18:1, 20:0, and 22:0) and squalene correlated positively with the Koroneiki EVOOs. When student’s t-test was applied, it turned out that all variables were statistically significant (p < 0.05) between the two cultivars except from α-tocopherol, implying that its content is not dependent on variety.

2.3. Classification of EVOOs According to Cultivar

The results can be better visualized using a heatmap (). γ-Tocopherol, 20:1, 18:2, and 18:3 are present at higher levels in samples from the Kolovi cultivar and lower in the Koroneiki cultivar. The rest of the components display the opposite pattern, except for α-tocopherol, which does not show a specific pattern between the two cultivars.

4.1. Olive Oil Samples

A total of 68 monovarietal EVOOs were obtained during the harvesting period of 2018–2019 (). They were produced from two cultivars (Kolovi and Koroneiki) in three different geographical regions of Greece (Crete island, Lesvos island, and Peloponnese). The samples were packaged in dark-brown glass bottles and stored at 4 °C until analysis.

Methods

In this randomized, double‐blind, placebo‐controlled clinical trial, 84 PCOS patients were randomly assigned into the treatment (90 µg Menaquinone‐7 daily for 8 weeks) and placebo groups. Insulin resistance, lipid profile, endocrine biomarkers, and body composition of the participants were measured before and after the intervention. This study was performed in Ghadir Mother & Child Hospital affiliated to Shiraz University of Medical Sciences, Shiraz, Iran.

Results

Menaquinone‐7 supplementation, when compared to placebo, significantly decreased serum fasting insulin (p = .002), homeostasis model of assessment insulin resistance (p = .002), and homeostasis model of assessment β‐cell function (p = .02) in addition to a significant increase in quantitative insulin sensitivity check index (p = .001). Also, MK‐7 administration led to significant declines in serum triglyceride (p = .003) and dihydrotestosterone (DHT; p = .03) levels, free androgen index (p < .001), waist circumference (p = .03), and body fat mass (p < .001) as well as significant increases in skeletal muscle (p < .001) and sex hormone binding globulin (SHBG, p < .001).

Study design

Polycystic ovary syndrome participants were randomized into the control and treatment arms by block randomization with fixed block size of four by means of random allocation software (Saghaei, ). The treatment group consumed one vitamin K2 capsule, containing 90 µg of Menaquinone‐7 (MK‐7), daily for 8 weeks; the dosage was administered in a previous study (Razavi et al., ). Patients in the control group received a placebo capsule (avesil) daily for 8 weeks. The MK‐7 and placebo capsules were identical in color (white), smell, size (size 0), and weight which were prepared for this study by Arian Salamat Sina Company to blind the participants, researchers, and the Infertility Clinic staff to group allocation (Fermented soybean called natto was the food source of MK‐7 used in this study). A booklet containing PCOS dietary recommendation was given to both groups. The participants were requested not to change their regular physical activity level and diet and in the course of study.

Abstract

Chemically synthesized retinyl palmitate has been widely used in the cosmetic and biotechnology industry. In this study, we aimed to demonstrate the microbial production of retinyl palmitate and the benefits of microbial retinyl palmitate in skin physiology. A heterologous retinyl palmitate biosynthesis pathway was reconstructed in metabolically engineered Escherichia coli using synthetic expression modules from Pantoea agglomerans, Salinibacter ruber, and Homo sapiens. High production of retinyl palmitate (69.96 ± 2.64 mg/L) was obtained using a fed-batch fermentation process. Moreover, application of purified microbial retinyl palmitate to human foreskin HS68 fibroblasts led to increased cellular retinoic acid-binding protein 2 (CRABP2) mRNA level [1.7-fold (p = 0.001) at 100 μg/mL], acceleration of cell proliferation, and enhancement of procollagen synthesis [111% (p < 0.05) at 100 μg/mL], strongly indicating an anti-ageing-related effect of this substance. These results would pave the way for large-scale production of retinyl palmitate in microbial systems and represent the first evidence for the application of microbial retinyl palmitate as a cosmeceutical.

Abstract

Chemically synthesized retinyl palmitate has been widely used in the cosmetic and biotechnology industry. In this study, we aimed to demonstrate the microbial production of retinyl palmitate and the benefits of microbial retinyl palmitate in skin physiology. A heterologous retinyl palmitate biosynthesis pathway was reconstructed in metabolically engineered Escherichia coli using synthetic expression modules from Pantoea agglomerans, Salinibacter ruber, and Homo sapiens. High production of retinyl palmitate (69.96 ± 2.64 mg/L) was obtained using a fed-batch fermentation process. Moreover, application of purified microbial retinyl palmitate to human foreskin HS68 fibroblasts led to increased cellular retinoic acid-binding protein 2 (CRABP2) mRNA level [1.7-fold (p = 0.001) at 100 μg/mL], acceleration of cell proliferation, and enhancement of procollagen synthesis [111% (p < 0.05) at 100 μg/mL], strongly indicating an anti-ageing-related effect of this substance. These results would pave the way for large-scale production of retinyl palmitate in microbial systems and represent the first evidence for the application of microbial retinyl palmitate as a cosmeceutical.

1. Introduction

In this study, we aimed to reconstruct a retinyl palmitate biosynthesis pathway in a β-carotene-overproducing E. coli strain engineered for enhancement of isoprenyl pyrophosphate and β-carotene biosynthesis. High-yield retinyl palmitate was obtained using fed-batch fermentation of retinyl palmitate-producing E. coli. Moreover, we evaluated the anti-ageing-related activity of the microbial retinyl palmitate purified from the engineered E. coli in human foreskin fibroblasts.

Abstract

The synthetic properties of the Thiamine diphosphate (ThDP)-dependent pyruvate dehydrogenase E1 subunit from Escherichia coli (EcPDH E1) was assessed for carboligation reactions with aliphatic ketoacids. Due to its role in metabolism, EcPDH E1 was previously characterised with respect to its biochemical properties, but it was never applied for synthetic purposes. Here, we show that EcPDH E1 is a promising biocatalyst for the production of chiral α-hydroxyketones. WT EcPDH E1 shows a 180–250-fold higher catalytic efficiency towards 2-oxobutyrate or pyruvate, respectively, in comparison to engineered transketolase variants from Geobacillus stearothermophilus (TKGST). Its broad active site cleft allows for the efficient conversion of both (R)- and (S)-configured α-hydroxyaldehydes, next to linear and branched aliphatic aldehydes as acceptor substrates under kinetically controlled conditions. The alternate, thermodynamically controlled self-reaction of aliphatic aldehydes was shown to be limited to low levels of conversion, which we propose to be due to their large hydration constants. Additionally, the thermodynamically controlled approach was demonstrated to suffer from a loss of stereoselectivity, which makes it unfeasible for aliphatic substrates.

2.1.2. Optimisation of Reaction Conditions

A spectrophotometric assay utilising 2,6-dichloroindophenol (DCPIP) and pyruvate as substrates () was initially used to identify optimal conditions for EcPDH E1 catalysed reactions []. The reduction in DCPIP was followed at its isosbestic point (517 nm, ) to allow for the determination of the optimal pH. E1 retained its activity over a broad pH range from pH 5.5 to 9.5, with its highest activity at pH 7.5 (a). The enzyme showed good thermal stability with no loss of activity after two hours of incubation at 40 °C. However, higher temperatures swiftly lead to its complete inactivation (b). Notably, EcPDH E1 can be stored with no loss of activity for at least six months at −20 °C (5 mg/mL EcPDH E1 in 20 mM potassium phosphate buffer, pH 7.0).

2.2. AUCs for (6S)-5-Methyl-THF-Ca Versus Folic Acid and Methods of Indirect Comparisons with the AUCs for (6S)-5-Methyl-THF-Na

Prinz-Langenohl et al. (2009) compared the AUC0–8 h of plasma total folate between (6S)-5-Methyl-THF-Ca and folic acid in 24 young women []. shows a brief summary of the study design compared to the present study. Equimolar oral doses of (6S)-5-Methyl-THF-Na (436 µg, present study) and (6S)-5-Methyl-THF-Ca (451 µg, in Prinz-Langenohl et al.) have been tested against the same reference substance, folic acid (400 µg). Plasma concentrations of (6S)-5-Methyl-THF were selectively measured in both studies. In the study by Prinz-Langenohl et al., 2009 [], the measurements of plasma (6S)-5-Methyl-THF were conducted at VU University Medical Centre, Department of Clinical Chemistry, Amsterdam (The Netherlands), by using liquid chromatography tandem mass-spectrometer (LC-MS-MS system) using 13C5-(6S)-5-Methyl-THF as internal standard []. We here show novel data on the AUC0–8 h of plasma (6S)-5-Methyl-THF from the original study [].

2.2. Synthesis

To first synthesize tungsten-doped VEG (W-VEG), NH4VO3 (1.17 g, 10 mmol), 1-dodecanol (33.17 g, 17.8 mmol), and EG (11.05 g, 17.8 mmol) were added to a three-necked round-bottom flask and mixed with stirring. To this mixture solution, a pre-determined amount of WOCl4 (0.094 g [0.277 mmol, 2.77 mol% to NH4VO3], 0.188 g [0.553 mmol, 5.53 mol%), and 0.377 g [1.109 mmol, 11.08 mol%]) was added, and the resulting reaction mixture was heated to 160 °C at a ramping rate of 5 °C/min and stirred for 2 h. Then, the mixture with a purple color was naturally cooled down to room temperature. The precipitate was collected by centrifuging the solution at 8000 rpm for 15 min to remove the excess 1-dodecanol and EG. The collected purple powder was washed with ethanol, filtered to obtain W-VEG powder, and dried in a vacuum for 24 h at room temperature.

2. Vitamin K Structure, Source, Cycle, Metabolism

Vitamin K is the term used to name a family of fat-soluble compounds, which although differ in origin and/or function, share a common 2-methyl-1,4-naphthoquinone ring, but differ in the (lipophilic) side chains linked at the 3-position. The three main forms are vitamin PK or phylloquinone (PK), vitamin K2 or menaquinones (MKn) and vitamin K3 or menadione. These three forms can be differentiated by the 3-position: PK has an isoprenoid side chain, whereas the MK form possesses a phytyl side chain and is characterized by a variable number of connected isoprenoid units (MKn), and menadione has no side chain and is a synthetic analogue [].

2. Vitamin K Structure, Source, Cycle, Metabolism

The sources of vitamin K are different depending on the vitamers. PK can be found mainly in green leafy vegetables (e.g., kale), vegetables in the Brassica genus (e.g., Brussels sprouts, broccoli), fruits (e.g., avocado, kiwi, and green grapes), herbs (e.g., cilantro, parsley), and green and herbal teas. Other dietary sources are plant oils such as soybean, canola, and olive oils [].

4. Vitamin K Recommended Intake, Deficiency, and Assessment

The recommended daily intake (RDI) or adequate intake (AI) of vitamin K is aimed at ensuring normal blood coagulation []. There is some variability of these recommended target values across various organizations. The National Academy of Medicine in the US stated the AI of vitamin PK at 120 μg/day for adult men and 90 μg/day for adult women []. The World Health Organization and the Food and Agriculture Organization recommended dosages for vitamin PK at 65 μg/day for men and 55 μg/day for women, based on a calculated requirement of 1 μg/day/kg body weight []. Finally, the European Commission has established a recommended daily allowance (RDA) for vitamin K at 75 μg/day []. In 2012, the Italian LARN (Reference Assumption Levels for Nutrients and Energy), proposed by the Human Nutrition Italian Society (SINU) suggested an intake of vitamin K stratified for age (140 or 170 μg/day for 18–59 and >60 years old, respectively) [].

2. Vitamin K Structure, Source, Cycle, Metabolism

Vitamin K acts as a cofactor for a single microsomal enzyme, namely carboxyglutamyl carboxylase (GGCX) which catalyzes the carboxylation (and thereby activation) of vitamin-K-dependent proteins (VKDPs) []. Vitamin-K-dependent carboxylase catalyzes the posttranslational γ-carboxylation of glutamic acid (Glu) residues, placed in vitamin K-dependent proteins (also known as Gla proteins), to γ-carboxylated glutamic acid (Gla) residues. Among the Gla protein family, 17 different members have been recongnized: S prothrombin, factor VII, factor IX, factor X, protein C, protein S and protein Z belonging to the coagulative cascade; (matrix Gla protein,(MGP), Osteocalcin (OC), growth arrest-specific protein 6 (Gas6), Gla-rich protein (GRP) playing a role in modulating bone and vascular mineralization; periostin and periostin-like factor, two proline-rich Gla proteins, and two transmembrane Gla proteins. Vitamin K was previously considered only an essential factor for blood coagulation [].

2. Vitamin K Structure, Source, Cycle, Metabolism

The involvement of vitamin K in bone metabolism does not occur exclusively by the γ-carboxylation reaction. MK4, binds to the nuclear receptor, steroid, and xenobiotic receptor (SXR) and its murine ortholog, pregnane X receptor (PXR), a nuclear receptor whose primary function is to regulate the expression of genes encoding enzymes involved in steroid metabolism and detoxification of xenobiotics and various drugs [,,]. Vitamin PK is not able to activate SXR directly, suggesting vitamin PK potentially contribute to this mechanism of action after being converted into MK-4 [] ().

2.1. Tn Antigen Expression in CRC

We conducted immunohistochemistry for Tn antigen using surgically resected whole tissue specimens, including 20 adenomas and 507 primary CRCs, in which 460 adjacent non-tumor mucosa were also available for evaluation. Immunoreactivity for Tn antigen staining in the cytoplasm and cell membrane were respectively evaluated and then combined to obtain the Tn score, as described in . In tumor adjacent mucosa, non-neoplastic epithelial cells often displayed weak to moderate granular staining predominantly in the supranuclear cytoplasm, but membranous staining was undetectable ( and A–F). The staining patterns of Tn antigen in adenomas were similar to those of non-tumor mucosa. We observed 35.2% of non-tumor mucosa, and 45.0% of adenomas were positive for Tn antigen expression (G). By contrast, in CRC tissues, the cytoplasmic and membranous expression of Tn antigen was observed in cancer cells with considerably varying degrees of staining intensity and its extent, occasionally accompanied by staining in the extracellular mucin deposit ( and A–F). Of the 507 CRC tissues, 189 (37.3%) were defined as Tn-negative (Tn score 0–3) and 318 (62.7%) were defined as Tn-positive (Tn score 4–24), and the latter was further classified into 277 Tn-weak (Tn score 4–15) (54.6%) and 41 Tn-strong (Tn score 16–24) (8.1%) tumors (G). In Tn-strong tumors, intense cytoplasmic and membranous staining was diffusely distributed throughout the tumor ( and A–C).

3. Discussion

The expression of Tn antigen in CRC has been studied since more than three decades ago. Earlier studies analyzed a relatively small number of specimens (less than 30 CRC tissues), and revealed that 72–82% of CRCs were found to be positive for Tn antigen expression [,,]. Oshikiri et al. reported that 68 of 146 CRCs (46.6%) were Tn positive []. More recently, Jiang et al. examined 186 CRC specimens, and 161 (86.6%) were determined to be positive for Tn antigen []. Although the Tn antigen positive rate varied among studies likely due to the detection approaches, including different monoclonal antibodies or lectins used, the expression pattern and the localization of Tn staining in CRC was highly consistent. In the present study, in a large cohort of CRC (n = 507), using a monoclonal antibody MLS128 for immunohistochemistry, we again confirmed that the majority (62.7%) of CRCs were positive for Tn antigen. Nevertheless, unlike previous studies described above, we herein identified a small subset of CRCs (8.1%) displaying strikingly intense and diffuse distributions of Tn antigen expression. Although none of the previous studies addressed the correlation between Tn antigen and MMR status, we found that the Tn-strong tumors were highly enriched within dMMR CRCs, where 16 of 40 (40.0%) of dMMR tumors were determined to be Tn-strong, which was in clear contrast to only 5.4% of pMMR tumors showing Tn-strong. More noteworthy is the fact that the unique subset of Tn-strong dMMR CRCs specifically lacked common immunological characteristics of dMMR CRC, such as dense CD8+ T cell infiltrate in the TME and PD-L1 expression on tumor cells. High levels of TILs have been considered not only an indicator of host immune response to the tumor, but also a favorable prognostic marker in CRC, independent of MMR status []. Particularly, in early stage patients with dMMR CRC, the pronounced anti-tumor immune response characterized by an increased density of intratumoral T cells seems to explain their generally good prognosis. A recent report demonstrated that a high number of TILs, along with high TMB, was correlated with clinical responses and survival benefit in patients with dMMR CRCs who were treated with ICIs []. By contrast, unresponsiveness to ICI treatment in pMMR CRCs is likely associated with low TMB and the lack of immune infiltration due to low tumor neoantigens. Our finding therefore suggests that Tn antigen overexpression is one of the underlying mechanisms of T cell exclusion in dMMR CRC. Although this study lacks direct assessment of the predictive role of Tn-strong for the efficacy of ICIs in patients with dMMR CRC, the Tn-strong dMMR subset may represent an immune cold subgroup of patients who do not respond well to the current immunotherapeutic strategies. Future studies would be required to address the prognostic as well as predictive roles of Tn-strong expression, particularly in patients with metastatic dMMR CRC who are treated with ICIs.

4.1. Patient Samples

We enrolled 20 patients with colon adenoma and 507 patients with stage 0 to IV primary CRC who underwent surgical resection at Fukushima Medical University Hospital between 2002 and 2013 without preoperative chemotherapy or radiotherapy. Their available formalin-fixed paraffin-embedded (FFPE) whole tissue sections were used for immunohistochemistry. Clinical information was retrospectively obtained from medical records. The study was conducted in accordance with the Declaration of Helsinki and was approved by the Institutional Review Board of Fukushima Medical University.

Introduction

We determined the crystal structures of BhNiaR with apo and niacin-bound forms. A zinc ion was included in both the apo and niacin-bound models. The presence of the zinc was confirmed by an inductively coupled plasma mass spectrometer (ICP-MS). The structural data of BhNiaR provides details of metal binding and ligand interaction. DNA binding affinity of BhNiaR depending on niacin or metal ions was assessed by electrophoretic mobility shift assay (EMSA).

Model building and quality

The apo crystal structure of BhNiaR was refined to 2.0 Å resolution with crystallographic Rwork and Rfree values of 20.18% and 22.78%, respectively. Although the refined model contained a subunit in an asymmetric unit composed of 173 residues with a zinc ion and 129 water molecules, it could be generated to a homo-dimeric structure by a symmetric subunit. The N-terminal domain is composed of residues 7–70 and C-terminal domain is composed of residues 71–179. The N-terminal region (residues 1–6), the linker loop region (residues 68–74) connecting the N- and C-terminal domains, and the internal region (residues 137–147) in the C-terminal domain were poorly ordered due to lack of electron-density maps. The niacin-bound BhNiaR crystals were grown by co-crystallization with 2 mM niacin. The structure of the niacin-bound form was determined at 1.8 Å resolution and refined to crystallographic Rwork and Rfree of 19.43% and 24.26%, respectively. The refined model of niacin-bound BhNiaR also contained a subunit with interpretable residues 7–179 in an asymmetric unit. The N-terminus (residues 1–6), the linker loop region (residues 68–74), and the internal region (residues 137–145) in the C-terminal domain were poorly ordered. A niacin molecule was located near a zinc ion and surrounded by a hydrophobic pocket close to the dimeric interface. All refined models for BhNiaR indicated favored or allowed regions of the Ramachandran plot. The detailed refinement statistics are summarized in Table .

DNA binding affinity

To confirm the DNA-binding affinity of BhNiaR with its predicted cognate DNA segments, we performed EMSA using the type I DNA, 34-bp oligonucleotide (5′–CTCATTTACAT ATGTCTTGACATCTATATTTACA–3′) containing the nifS-nadB promoter region. The DNA was mixed with various amount of BhNiaR either in the absence or presence of niacin. BhNiaR bound to its cognate DNA with a dissociation constant (Kd) of ~ 0.5 µM in the presence of niacin, whereas the DNA-binding ability was decreased in the absence of niacin (Fig. a). BhNiaR moderately reduced DNA-binding to non-cognate sequences either with or without niacin (Fig. b). These results are consistent with homologous NiaR proteins from B. subtilis and T. maritima.

DNA binding affinity

To further assess whether the metal ion affects the DNA-binding affinity of BhNiaR, a BhNiaR H152A mutant was generated by site-directed mutagenesis resulting in metal-free BhNiaR, which was confirmed by an ICP-MS. The BhNiaR H152A mutant showed a severe defect in DNA-binding affinity regardless of the presence or absence of niacin (Fig. c). These results indicate that the metal ion, as well as niacin, plays an important role in DNA binding.

Conclusion

The crystal structures of the niacin-responsive repressor, BhNiaR, which negatively regulates the expression of genes involved in the NAD+ synthesis pathway, were determined to be the apo and niacin-bound forms. Our results show the coordination of a zinc ion and the binding of the effector molecule, niacin, in the NiaR structure. In the apo form, the zinc ion is coordinated by three residues (Glu91, His150, and His152) conserved in HPr-like proteins with a water molecule in tetrahedral geometry. Another conserved residue, His83, is not involved in zinc ion coordination but is involved in niacin binding. The niacin bound to the C-terminal domain of BhNiaR is located near a zinc ion, His83, and a well-conserved hydrophobic pocket. Both the niacin and the metal ion cooperatively affect DNA-binding affinity of BhNiaR, and the EMSA results show that the absence of a metal ion causes a significant defect in the DNA-binding affinity of BhNiaR.

Abstract

Țaga cheese is a traditional Romanian smear-ripened cheese made from bovine milk and identified with the name of the village and caves where it is produced. As no previously reported microbiological and chemical studies have been undertaken on this product, this research aimed to investigate the microbiological and biochemical characteristics which ensure the uniqueness of Țaga cheese during the ripening process, to inform producers as to key quality determinants. Cheese samples, consisting of retail blocks, were collected on days 2, 5, 12, 18, and 25 of the ripening process. The evolution of lactic microbiota during the production and maturation of traditional cheeses involves isolating lactic acid microorganisms present in cheese. Cheese samples were analyzed for pH, fat, NaCl, fatty acids, and volatile compounds. The microbial ecosystem naturally changes during the maturation process, leading to variation in the microorganisms involved during ripening. Our results show that specific bacteria were identified in high levels during the entire ripening process and may be responsible for milk fat lipolysis contributing directly to cheese flavor by imparting detailed fatty acid flavor notes, or indirectly as precursors formation of other flavor compounds.

Introduction

Țaga cheese, also known as Năsal cheese, is a raw milk cheese named after one of the villages in the Transilvania region of Romania. It is an acid-curd cheese with a creamy texture, exhibiting a very strong pungent flavor with a slightly spicy taste []. Currently, it is produced from cow's milk by the Someș Arieș Agricultural Cooperative and it is certified as a traditional Romanian product. Approximately 51100 kg of Țaga cheese is produced annually. Locally, this cheese is considered unique because its maturation takes place in a special microbiological environment from the natural cave from Țaga. The caves' conditions are typical temperatures of 14–15°C and an air relative humidity of 90–95%, mostly constant throughout the year. These conditions could potentially favor the development of a specific selection of bacteria, such as Brevibacterium linens during the ripening process which may be responsible for the transformation of the cheese into a highly appreciated specialty by the costumers.

Introduction

Maturation takes 25–30 days, and during this period, the cheeses are turned over daily during the first week, and subsequently every 2–3 days. The cheeses are washed with brine at these times, with a concentration of 10% (w/v). During this time, the surface coloration develops with characteristic surface bacteria. Once the maturation process is completed, the cheeses are again washed, then left to dry. Then the cheese surface is dusted with starch powder, and it is packed in parchment paper. The amount of Țaga cheese that is produced daily is approximatively 140 kg.

Sampling

For this study, Țaga cheese samples were collected directly from the manufacturer, Someș Arieș Agricultural Co-operative, andsampling was undertaken 2, 5, 12, 18, and 25 days after cheese production initiation. Each sample set consisted of three 'bricks' of cheese (each approximately 300 g) taken from one day's cheese production, i.e., from a single batch of milk and the same vat. The three samples were collected in individual sterile plastic bags, deposited in the laboratory's refrigerator at 4°C and collected on the same day for shipment to the analytical laboratory under chilled conditions. Analyses were initiated on the day of sampling. Each set of three samples were subjected to all analyses; hence they were all undertaken in triplicate.