Läs källbundna sammanställningar.

2.1. Tn Antigen Expression in CRC

We conducted immunohistochemistry for Tn antigen using surgically resected whole tissue specimens, including 20 adenomas and 507 primary CRCs, in which 460 adjacent non-tumor mucosa were also available for evaluation. Immunoreactivity for Tn antigen staining in the cytoplasm and cell membrane were respectively evaluated and then combined to obtain the Tn score, as described in . In tumor adjacent mucosa, non-neoplastic epithelial cells often displayed weak to moderate granular staining predominantly in the supranuclear cytoplasm, but membranous staining was undetectable ( and A–F). The staining patterns of Tn antigen in adenomas were similar to those of non-tumor mucosa. We observed 35.2% of non-tumor mucosa, and 45.0% of adenomas were positive for Tn antigen expression (G). By contrast, in CRC tissues, the cytoplasmic and membranous expression of Tn antigen was observed in cancer cells with considerably varying degrees of staining intensity and its extent, occasionally accompanied by staining in the extracellular mucin deposit ( and A–F). Of the 507 CRC tissues, 189 (37.3%) were defined as Tn-negative (Tn score 0–3) and 318 (62.7%) were defined as Tn-positive (Tn score 4–24), and the latter was further classified into 277 Tn-weak (Tn score 4–15) (54.6%) and 41 Tn-strong (Tn score 16–24) (8.1%) tumors (G). In Tn-strong tumors, intense cytoplasmic and membranous staining was diffusely distributed throughout the tumor ( and A–C).

3. Discussion

The expression of Tn antigen in CRC has been studied since more than three decades ago. Earlier studies analyzed a relatively small number of specimens (less than 30 CRC tissues), and revealed that 72–82% of CRCs were found to be positive for Tn antigen expression [,,]. Oshikiri et al. reported that 68 of 146 CRCs (46.6%) were Tn positive []. More recently, Jiang et al. examined 186 CRC specimens, and 161 (86.6%) were determined to be positive for Tn antigen []. Although the Tn antigen positive rate varied among studies likely due to the detection approaches, including different monoclonal antibodies or lectins used, the expression pattern and the localization of Tn staining in CRC was highly consistent. In the present study, in a large cohort of CRC (n = 507), using a monoclonal antibody MLS128 for immunohistochemistry, we again confirmed that the majority (62.7%) of CRCs were positive for Tn antigen. Nevertheless, unlike previous studies described above, we herein identified a small subset of CRCs (8.1%) displaying strikingly intense and diffuse distributions of Tn antigen expression. Although none of the previous studies addressed the correlation between Tn antigen and MMR status, we found that the Tn-strong tumors were highly enriched within dMMR CRCs, where 16 of 40 (40.0%) of dMMR tumors were determined to be Tn-strong, which was in clear contrast to only 5.4% of pMMR tumors showing Tn-strong. More noteworthy is the fact that the unique subset of Tn-strong dMMR CRCs specifically lacked common immunological characteristics of dMMR CRC, such as dense CD8+ T cell infiltrate in the TME and PD-L1 expression on tumor cells. High levels of TILs have been considered not only an indicator of host immune response to the tumor, but also a favorable prognostic marker in CRC, independent of MMR status []. Particularly, in early stage patients with dMMR CRC, the pronounced anti-tumor immune response characterized by an increased density of intratumoral T cells seems to explain their generally good prognosis. A recent report demonstrated that a high number of TILs, along with high TMB, was correlated with clinical responses and survival benefit in patients with dMMR CRCs who were treated with ICIs []. By contrast, unresponsiveness to ICI treatment in pMMR CRCs is likely associated with low TMB and the lack of immune infiltration due to low tumor neoantigens. Our finding therefore suggests that Tn antigen overexpression is one of the underlying mechanisms of T cell exclusion in dMMR CRC. Although this study lacks direct assessment of the predictive role of Tn-strong for the efficacy of ICIs in patients with dMMR CRC, the Tn-strong dMMR subset may represent an immune cold subgroup of patients who do not respond well to the current immunotherapeutic strategies. Future studies would be required to address the prognostic as well as predictive roles of Tn-strong expression, particularly in patients with metastatic dMMR CRC who are treated with ICIs.

4.1. Patient Samples

We enrolled 20 patients with colon adenoma and 507 patients with stage 0 to IV primary CRC who underwent surgical resection at Fukushima Medical University Hospital between 2002 and 2013 without preoperative chemotherapy or radiotherapy. Their available formalin-fixed paraffin-embedded (FFPE) whole tissue sections were used for immunohistochemistry. Clinical information was retrospectively obtained from medical records. The study was conducted in accordance with the Declaration of Helsinki and was approved by the Institutional Review Board of Fukushima Medical University.

Introduction

We determined the crystal structures of BhNiaR with apo and niacin-bound forms. A zinc ion was included in both the apo and niacin-bound models. The presence of the zinc was confirmed by an inductively coupled plasma mass spectrometer (ICP-MS). The structural data of BhNiaR provides details of metal binding and ligand interaction. DNA binding affinity of BhNiaR depending on niacin or metal ions was assessed by electrophoretic mobility shift assay (EMSA).

Model building and quality

The apo crystal structure of BhNiaR was refined to 2.0 Å resolution with crystallographic Rwork and Rfree values of 20.18% and 22.78%, respectively. Although the refined model contained a subunit in an asymmetric unit composed of 173 residues with a zinc ion and 129 water molecules, it could be generated to a homo-dimeric structure by a symmetric subunit. The N-terminal domain is composed of residues 7–70 and C-terminal domain is composed of residues 71–179. The N-terminal region (residues 1–6), the linker loop region (residues 68–74) connecting the N- and C-terminal domains, and the internal region (residues 137–147) in the C-terminal domain were poorly ordered due to lack of electron-density maps. The niacin-bound BhNiaR crystals were grown by co-crystallization with 2 mM niacin. The structure of the niacin-bound form was determined at 1.8 Å resolution and refined to crystallographic Rwork and Rfree of 19.43% and 24.26%, respectively. The refined model of niacin-bound BhNiaR also contained a subunit with interpretable residues 7–179 in an asymmetric unit. The N-terminus (residues 1–6), the linker loop region (residues 68–74), and the internal region (residues 137–145) in the C-terminal domain were poorly ordered. A niacin molecule was located near a zinc ion and surrounded by a hydrophobic pocket close to the dimeric interface. All refined models for BhNiaR indicated favored or allowed regions of the Ramachandran plot. The detailed refinement statistics are summarized in Table .

DNA binding affinity

To confirm the DNA-binding affinity of BhNiaR with its predicted cognate DNA segments, we performed EMSA using the type I DNA, 34-bp oligonucleotide (5′–CTCATTTACAT ATGTCTTGACATCTATATTTACA–3′) containing the nifS-nadB promoter region. The DNA was mixed with various amount of BhNiaR either in the absence or presence of niacin. BhNiaR bound to its cognate DNA with a dissociation constant (Kd) of ~ 0.5 µM in the presence of niacin, whereas the DNA-binding ability was decreased in the absence of niacin (Fig. a). BhNiaR moderately reduced DNA-binding to non-cognate sequences either with or without niacin (Fig. b). These results are consistent with homologous NiaR proteins from B. subtilis and T. maritima.

DNA binding affinity

To further assess whether the metal ion affects the DNA-binding affinity of BhNiaR, a BhNiaR H152A mutant was generated by site-directed mutagenesis resulting in metal-free BhNiaR, which was confirmed by an ICP-MS. The BhNiaR H152A mutant showed a severe defect in DNA-binding affinity regardless of the presence or absence of niacin (Fig. c). These results indicate that the metal ion, as well as niacin, plays an important role in DNA binding.

Conclusion

The crystal structures of the niacin-responsive repressor, BhNiaR, which negatively regulates the expression of genes involved in the NAD+ synthesis pathway, were determined to be the apo and niacin-bound forms. Our results show the coordination of a zinc ion and the binding of the effector molecule, niacin, in the NiaR structure. In the apo form, the zinc ion is coordinated by three residues (Glu91, His150, and His152) conserved in HPr-like proteins with a water molecule in tetrahedral geometry. Another conserved residue, His83, is not involved in zinc ion coordination but is involved in niacin binding. The niacin bound to the C-terminal domain of BhNiaR is located near a zinc ion, His83, and a well-conserved hydrophobic pocket. Both the niacin and the metal ion cooperatively affect DNA-binding affinity of BhNiaR, and the EMSA results show that the absence of a metal ion causes a significant defect in the DNA-binding affinity of BhNiaR.

Abstract

Țaga cheese is a traditional Romanian smear-ripened cheese made from bovine milk and identified with the name of the village and caves where it is produced. As no previously reported microbiological and chemical studies have been undertaken on this product, this research aimed to investigate the microbiological and biochemical characteristics which ensure the uniqueness of Țaga cheese during the ripening process, to inform producers as to key quality determinants. Cheese samples, consisting of retail blocks, were collected on days 2, 5, 12, 18, and 25 of the ripening process. The evolution of lactic microbiota during the production and maturation of traditional cheeses involves isolating lactic acid microorganisms present in cheese. Cheese samples were analyzed for pH, fat, NaCl, fatty acids, and volatile compounds. The microbial ecosystem naturally changes during the maturation process, leading to variation in the microorganisms involved during ripening. Our results show that specific bacteria were identified in high levels during the entire ripening process and may be responsible for milk fat lipolysis contributing directly to cheese flavor by imparting detailed fatty acid flavor notes, or indirectly as precursors formation of other flavor compounds.

Introduction

Țaga cheese, also known as Năsal cheese, is a raw milk cheese named after one of the villages in the Transilvania region of Romania. It is an acid-curd cheese with a creamy texture, exhibiting a very strong pungent flavor with a slightly spicy taste []. Currently, it is produced from cow's milk by the Someș Arieș Agricultural Cooperative and it is certified as a traditional Romanian product. Approximately 51100 kg of Țaga cheese is produced annually. Locally, this cheese is considered unique because its maturation takes place in a special microbiological environment from the natural cave from Țaga. The caves' conditions are typical temperatures of 14–15°C and an air relative humidity of 90–95%, mostly constant throughout the year. These conditions could potentially favor the development of a specific selection of bacteria, such as Brevibacterium linens during the ripening process which may be responsible for the transformation of the cheese into a highly appreciated specialty by the costumers.

Introduction

Maturation takes 25–30 days, and during this period, the cheeses are turned over daily during the first week, and subsequently every 2–3 days. The cheeses are washed with brine at these times, with a concentration of 10% (w/v). During this time, the surface coloration develops with characteristic surface bacteria. Once the maturation process is completed, the cheeses are again washed, then left to dry. Then the cheese surface is dusted with starch powder, and it is packed in parchment paper. The amount of Țaga cheese that is produced daily is approximatively 140 kg.

Sampling

For this study, Țaga cheese samples were collected directly from the manufacturer, Someș Arieș Agricultural Co-operative, andsampling was undertaken 2, 5, 12, 18, and 25 days after cheese production initiation. Each sample set consisted of three 'bricks' of cheese (each approximately 300 g) taken from one day's cheese production, i.e., from a single batch of milk and the same vat. The three samples were collected in individual sterile plastic bags, deposited in the laboratory's refrigerator at 4°C and collected on the same day for shipment to the analytical laboratory under chilled conditions. Analyses were initiated on the day of sampling. Each set of three samples were subjected to all analyses; hence they were all undertaken in triplicate.

Abstract

[6S]-5-methyltetrahydrofolic acid (MTHF) is a proposed replacement for folic acid (FA) in diets and prenatal supplements. This study compared the effects of these two forms on maternal metabolism and hypothalamic gene expression. Pregnant Wistar rats received an AIN-93G diet with recommended FA (1X, 2 mg/kg, control), 5X-FA or equimolar levels of MTHF. During lactation they received the control diet and then a high fat diet for 19-weeks post-weaning. Body weight, adiposity, food intake, energy expenditure, plasma hormones, folate, and 1-carbon metabolites were measured. RNA-sequencing of the hypothalamus was conducted at parturition. Weight-loss from weaning to 1-week post-weaning was less in dams fed either form of the 5X vs. 1X folate diets, but final weight-gain was higher in 5X-MTHF vs. 5X-FA dams. Both doses of the MTHF diets led to 8% higher food intake and associated with lower plasma leptin at parturition, but higher leptin at 19-weeks and insulin resistance at 1-week post-weaning. RNA-sequencing revealed 279 differentially expressed genes in the hypothalamus in 5X-MTHF vs. 5X-FA dams. These findings indicate that MTHF and FA differ in their programing effects on maternal phenotype, and a potential adverse role of either form when given at the higher doses.

2.1. Animals and Diets

All animal work was approved by the University of Toronto Animal Care Committee (#20011892). First-time pregnant Wistar rats (2–3 days, 170–250 g) were purchased from Charles River Farms (Quebec, Canada) and individually housed upon arrival. Animals were maintained on a reverse 12-h dark-light cycle (lights on at 07:00 a.m. at 22 ± 1 °C) and ad libitum food and water were provided throughout the study. Dams were randomly allocated to one of four dietary interventions that were provided contemporaneously and only during pregnancy until term (3 weeks). Pregnant dams (n = 16–18/group) received an isocaloric AIN-93G diet (energy density 4.0 kcal/g) [] containing either the recommended (1X, 2 mg/kg diet, control) or 5X-quantity of FA for rodents (1X-FA or 5X-FA) or equimolar recommended levels of [6S]-5-methyltetrahydrofolic acid, calcium salt (1X, 2.1 mg/kg diet, Metafolin®, Merck & Cie, Schaffhausen, Switzerland) or 5X-quantity of MTHF (1X-MTHF or 5X-MTHF). FA and MTHF diets at equimolar doses have been used in clinical trials assessing folate status and related-health effects [,,]. The recommended (1X) dose was chosen based on the FA requirements for rodents for adequate growth rate [] and reflects the FDA requirements for non-pregnant women (400 µg/day) []. The 5X dose was chosen to reflect FA intakes commonly consumed in North America above the basal dietary requirements for humans [,]. Diets were custom made by Research Diets Inc. (New Brunswick, NJ, USA) () and stored at 4 °C and in the dark until provided fresh weekly. The additions of the MTHF form of folate into foods has been shown to be stable at both 4 °C and room temperature for up to 24 months []. Analytical testing of the high folate diets following a 36-month storage at −80 °C showed >80% retention of folates (), further confirming their long-term stability.

Introduction

Sepsis is defined as a life-threatening organ dysfunction caused by a dysregulated host response to infection and is characterized by a dramatic increase in inducible nitric oxide synthase (NOS) expression and activity with excessive production of nitric oxide (NO) [,]. As a result, sepsis leads to endothelial dysfunction and profound systemic vasodilation with associated hypotension which can have deleterious effects [,]. Therefore, a careful, sustained reduction in NO burden represents a potential therapeutic target. Hydroxocobalamin (HCB), which has traditionally been used in the treatment of cyanide toxicity, affects NO-mediated vasoplegia by (1) directly inhibiting NOS, decreasing NO production, and (2) by binding directly to NO and acting as a scavenger [-]. HCB has been successfully used in the treatment of refractory vasoplegia, particularly in cardiac surgery and liver transplant patients [-], but has not been extensively explored in septic shock. Shapeton et al. comprehensively summarized the pharmacology, toxicology, and clinical evidence surrounding the use of HCB in vasoplegic patients []. In this case report, we describe how a single extended duration infusion of high-dose HCB facilitates the resolution of catecholamine-refractory septic shock.

Case presentation

A 73-year-old male with a 30-pack-year tobacco smoking history and poorly differentiated T4N0M0 right upper lobe lung adenocarcinoma status post-neoadjuvant chemotherapy underwent a right upper lobectomy. His comorbidities included type 2 diabetes mellitus, hyperlipidemia, and prostate cancer status post-radiation therapy and radical prostatectomy. He was discharged on postoperative day (POD) 12 but was re-admitted on POD 16 in the setting of a right-sided empyema and septic shock. After administration of empiric antibiotics, the patient was taken to the operating room for right thoracotomy with decortication. His intraoperative course was complicated by poor gas exchange with profound hypoxemia (arterial pO2/fraction inspired O2 or P/F ratio = 50; ref >300) and hypercarbia (partial pressure of carbon dioxide = 100 mmHg). In the context of this new-onset acute respiratory distress syndrome (ARDS) with poor compliance and associated elevated driving pressures (plateau pressure = 37 cmH20, positive end-expiratory pressure = 12 cmH20), the patient suffered an intraoperative, contralateral tension pneumothorax that required emergent needle decompression and subsequent left-sided chest tube placement. Intraoperatively, the patient required escalating doses of epinephrine, norepinephrine, and vasopressin to support hemodynamics. An intraoperative transthoracic echocardiogram (TTE) was performed, which revealed right ventricular (RV) dysfunction with an underfilled and hyperdynamic left ventricle (LV). These compounding factors resulted in a severe respiratory and metabolic acidosis with a pH of 7.1 at the time of arrival to the intensive care unit (ICU).

Case presentation

Despite normalization of his cardiac function (by bedside TTE and calculated CI), the patient continued to require high-dose infusions of norepinephrine (up to 0.09 mcg/kg/min), vasopressin (up to 0.04 units/min), and epinephrine (up to 0.1 mcg/kg/min), suggestive of vasodilatory shock. His vasopressor requirement did not improve after administration of stress dose steroids. Indeed, 23 hours after admission to the ICU, repeat central venous SatO2 was 73.9% for a calculated CI of 6 L/min/m2 by Fick. To address the refractory shock, he was given a one-time sustained infusion of HCB (5 g) administered over four hours. This resulted in a rapid, complete, and definitive weaning from all vasoactive agents over the ensuing 14 hours (Figure ).

Formation of bisretinoid fluorophores by reaction of vitamin a aldehyde with lipid

Incubation of bovine outer segments with all-trans-retinal mimics bisretinoid formation in vivo, and by optimizing the detection of these bisretinoid species, their formation by all-trans-retinal reactivity was confirmed (). Indeed, adjusting the ratio of all-trans-retinal to PE in synthetic mixtures to determine how the two precursors affect bisretinoid production showed that the yield of bisretinoid saturates when the ratio of equivalents of all-trans-retinal to PE (egg-PE as starting material) is 4:2; no further increase occurred with eight equivalents of all-trans-retinal (8:2 ratio) (). Conversely, increasing the concentration of PE from an equivalent ratio of 4:1 through 4:8 (all-trans-retinal to PE) was associated with a steady increase in bisretinoid product. These findings indicated that the concentration of PE in the environment of the outer segment membrane has a marked effect on the rate of bisretinoid synthesis. Formation of NRPE, the first step in the synthetic pathway, is likely the most facile reaction. In the Abca4−/− mouse, a mouse model exhibiting accelerated bisretinoid formation, the level of PE in the outer segment membrane was reported to be increased (). It has been suggested that a higher level of PE in Abca4−/− mice may facilitate sequestering of all-trans-retinal as NRPE, thereby accelerating recovery of the rod photoresponse after a 30–40% bleach ().

Formation of bisretinoid fluorophores by reaction of vitamin a aldehyde with lipid

The unsaturated fatty acid 22:6n-3 (DHA) is abundant in the outer segments of photoreceptor cells, and DHA content has been shown to have several effects on retina (), including susceptibility to light damage. When 22:6n-3-containing PE was used as precursor in the synthetic reaction mixture versus egg-PE (a mixture of fatty acid moieties), phosphatidyl-pyridinium bisretinoid (A2PE) production was found to be greater with the latter. Then again, if free DHA was added to the egg-PE/all-trans-retinal reaction mixture, the yield of A2PE was increased. Under deprotonating conditions associated with the addition of base (triethylamine) to the reactants, the generation of A2PE was increased. Altogether, not only is the phospholipid PE the reactant that combines with all-trans-retinal to form bisretinoid, the lipid composition of outer segments may also impact the extent to which the reaction may be favored.

Abstract

Background: to explore the diagnostic accuracy of 18F-Fluciclovine positron-emission tomography (PET) in prostate cancer (PCa), considering both primary staging prior to radical therapy, biochemical recurrence, and advanced setting. Methods: A systematic web search through Embase and Medline was performed according to the Preferred Reporting Items for Systematic Reviews and Meta-analyses (PRISMA) guidelines. Studies performed from 2011 to 2020 were evaluated. The terms used were “PET” or “positron emission tomography” or “positron emission tomography/computed tomography” or “PET/CT” or “positron emission tomography-computed tomography” or “PET-CT” and “Fluciclovine” or “FACBC” and “prostatic neoplasms” or “prostate cancer” or “prostate carcinoma”. Only studies reporting about true positive (TP), true negative (TN), false positive (FP) and false negative (FN) findings of 18F-fluciclovine PET were considered eligible. Results: Fifteen out of 283 studies, and 697 patients, were included in the final analysis. The pooled sensitivity for 18F-Fluciclovine PET/CT for diagnosis of primary PCa was 0.83 (95% CI: 0.80–0.86), the specificity of 0.77 (95% CI: 0.74–0.80). The pooled sensitivity for preoperative LN staging was 0.57 (95% CI: 0.39–0.73) and specificity of 0.99 (95% CI: 0.94–1.00). The pooled sensitivity for the overall detection of recurrence in relapsed patients was 0.68 (95% CI: 0.63–0.73), and specificity of 0.68 (95% CI: 0.60–0.75). Conclusion: This meta-analysis showed promising results in term of sensitivity and specificity for 18F-Fluciclovine PET/CT to stage the primary lesion and in the assessment of nodal metastases, and for the detection of PCa locations in the recurrent setting. However, the limited number of studies and the broad heterogeneity in the selected cohorts and in different investigation protocols are limitation affecting the strength of these results.

2. Materials and Methods

A systematic web search through Embase and Medline was performed according to the Preferred Reporting Items for Systematic Reviews and Meta-analyses (PRISMA) guidelines. Studies performed from 2011 to 2020 were evaluated. The terms used were “PET” or “positron emission tomography” or “positron emission tomography/computed tomography” or “PET/CT” or “positron emission tomography-computed tomography” or “PET-CT” and “Fluciclovine” or “FACBC” and “prostatic neoplasms” or “prostate cancer” or “prostate carcinoma”. Full-text publications in English were considered. The study population comprised male patients with histologically proven PCa. Studies using 18F-Fluciclovine in pre-surgery setting as well as biochemical recurrence and advanced setting were considered. Two investigators (C.C. and C.R.) independently performed the literature search. The inclusion criteria considered for each study included an assessment of true positive (TP), true negative (TN), false positive (FP), and false negative (FN) results of 18F-Fluciclovine PET or PET / CT for the diagnosis of primary cancer, lymph node staging and the detection of recurrence. Only studies providing these information were finally included in the study. The overall quality of the studies included was independently assessed by two authors, based on the 15 modified items Quality Assessment of Diagnostic Accuracy Studies (QUADAS-2, ) []. Discrepancies between researchers were resolved with consensus.

3.2.1. Detection of Primary Prostate Cancer Lesion

The per-patient pooled sensitivity for 18F-Fluciclovine PET/CT for the diagnosis of primary PCa was 0.83 (95% CI: 0.80–0.86), with I-square: 89.6% (a) and a pooled of specificity of 0.77 (95% CI: 0.74–0.80) with I –square: 94.8% (b). The likelihood ratio (LR) syntheses gave an overall LR+ of 5.22 (95% CI: 2.15–12.67) (c) and LR– of 0.17 (95% CI: 0.8–0.38) (d). The pooled DOR was 35.43 (95%CI: 6.66–188.55) (e). The SROC curve indicates that the area under the cure was: 0.9224 (f).

Abstract

The term vitamin B6 is a designation for the vitamers pyridoxal, pyridoxamine, pyridoxine and the respective phosphate esters pyridoxal-5′-phosphate (PLP), pyridoxamine-5′-phosphate and pyridoxine-5′-phosphate. Animals and humans are unable to synthesise vitamin B6. These organisms have to take up vitamin B6 with their diet. Therefore, vitamin B6 is of commercial interest as a food additive and for applications in the pharmaceutical industry. As yet, two naturally occurring routes for de novo synthesis of PLP are known. Both routes have been genetically engineered to obtain bacteria overproducing vitamin B6. Still, major genetic engineering efforts using the existing pathways are required for developing fermentation processes that could outcompete the chemical synthesis of vitamin B6. Recent suppressor screens using mutants of the Gram-negative and Gram-positive model bacteria Escherichia coli and Bacillus subtilis, respectively, carrying mutations in the native pathways or heterologous genes uncovered novel routes for PLP biosynthesis. These pathways consist of promiscuous enzymes and enzymes that are already involved in vitamin B6 biosynthesis. Thus, E. coli and B. subtilis contain multiple promiscuous enzymes causing a so-called underground metabolism allowing the bacteria to bypass disrupted vitamin B6 biosynthetic pathways. The suppressor screens also show the genomic plasticity of the bacteria to suppress a genetic lesion. We discuss the potential of the serendipitous pathways to serve as a starting point for the development of bacteria overproducing vitamin B6.

Abstract

The term vitamin B6 is a designation for the vitamers pyridoxal, pyridoxamine, pyridoxine and the respective phosphate esters pyridoxal-5′-phosphate (PLP), pyridoxamine-5′-phosphate and pyridoxine-5′-phosphate. Animals and humans are unable to synthesise vitamin B6. These organisms have to take up vitamin B6 with their diet. Therefore, vitamin B6 is of commercial interest as a food additive and for applications in the pharmaceutical industry. As yet, two naturally occurring routes for de novo synthesis of PLP are known. Both routes have been genetically engineered to obtain bacteria overproducing vitamin B6. Still, major genetic engineering efforts using the existing pathways are required for developing fermentation processes that could outcompete the chemical synthesis of vitamin B6. Recent suppressor screens using mutants of the Gram-negative and Gram-positive model bacteria Escherichia coli and Bacillus subtilis, respectively, carrying mutations in the native pathways or heterologous genes uncovered novel routes for PLP biosynthesis. These pathways consist of promiscuous enzymes and enzymes that are already involved in vitamin B6 biosynthesis. Thus, E. coli and B. subtilis contain multiple promiscuous enzymes causing a so-called underground metabolism allowing the bacteria to bypass disrupted vitamin B6 biosynthetic pathways. The suppressor screens also show the genomic plasticity of the bacteria to suppress a genetic lesion. We discuss the potential of the serendipitous pathways to serve as a starting point for the development of bacteria overproducing vitamin B6.

Introduction

Since animals and humans are unable to synthesise vitamin B6, these organisms have to take up vitamin B6 with their diet (Kraemer et al. ). Therefore, vitamin B6 is of commercial interest as a food additive and for applications in the pharmaceutical industry (Acevedo-Rocha et al. ). PN hypochloride, the commercial form of vitamin B6, is synthesised from PN and added usually in combination with other vitamins to food products like bakery products, cereals, baby nutrition, multivitamin juices and other beverages (Domke et al. ; Eggersdorfer et al. ). Moreover, PN is added to the food that is used for intensive animal farming to improve the yield (Johnson et al. ; Verbeek ; Eggersdorfer et al. ). Until today, the B6 vitamers are fully chemically synthesised using expensive and toxic chemicals (Eggersdorfer et al. ). Therefore, there is considerable interest in the biotech industry to develop a sustainable fermentation process for the production of vitamin B6.

Abstract

Natamycin (NAT) is the drug of choice for the treatment of fungal keratitis (FK). However, its inherent shortcomings, such as poor solubility, high dosing frequency, and long treatment cycle, need to be urgently addressed by designing a new delivery to widen its clinical utility. Growing research has confirmed that clotrimazole (CLZ) plays a significant role in fungal growth inhibition. Hence, coaxial electrospray (CO-ES) technology is used herein to prepare nano-systems with an average hydrodynamic particle size of 309-406 nm for the co-delivery of NAT and CLZ in chitosan (CTS) and poly(lactic-co-glycolic acid) (PLGA). The resulting NAT/CLZ@CTS/PLGA formulations were characterized by a transmission electron microscope (TEM) and in vitro release test. The results show that the formulations had obvious core-shell structures, uniform particle distribution, and also can sustain the release of drugs over 36 h. Furthermore, in vitro hemolysis, in vivo corneal irritation test, local allergenic test, and antifungal activity analyses are performed to evaluate the safety and efficiency of the formulations. Thus, good biosafety along with a significant anti-candidiasis effect are found in the NAT/CLZ@CTS/PLGA nanoparticles (NPs). Taken together, the results suggest that this design may provide a promising drug delivery system and a new option for the treatment of FK.

Preparation of Electro-Sprayed NPs

Various NP formulations were produced, including the single drug-loaded formulations (NAT@CTS/PLGA and CLZ@CTS/PLGA) and the co-loaded formulation NAT/CLZ@CTS/PLGA.

In vitro Drug Release

The in vitro release of NAT and CLZ from electro-sprayed NPs was performed using a dialysis bag (3,500 molecular weight cutoff, membrane-cell, Chicago, IL, United States) (). First, the samples were centrifuged at 12,000 rpm for 10 min and then the supernatant was discarded and the recovered NPs were rinsed with distilled water to exclude the free drugs. Subsequently, 2.0-ml samples were added into a dialysis bag, which was then immersed in PBS (50.0 ml) and gently swung at 37°C and 100 rpm. The release medium was sampled (1.0-ml) at predetermined time and immediately replaced with 1 ml fresh release medium (phosphate buffered saline, PBS, pH 7.4) after each sampling. The cumulative dose of NAT and CLZ was measured by HPLC method as described above.

Abstract

Natamycin (NAT) is the drug of choice for the treatment of fungal keratitis (FK). However, its inherent shortcomings, such as poor solubility, high dosing frequency, and long treatment cycle, need to be urgently addressed by designing a new delivery to widen its clinical utility. Growing research has confirmed that clotrimazole (CLZ) plays a significant role in fungal growth inhibition. Hence, coaxial electrospray (CO-ES) technology is used herein to prepare nano-systems with an average hydrodynamic particle size of 309-406 nm for the co-delivery of NAT and CLZ in chitosan (CTS) and poly(lactic-co-glycolic acid) (PLGA). The resulting NAT/CLZ@CTS/PLGA formulations were characterized by a transmission electron microscope (TEM) and in vitro release test. The results show that the formulations had obvious core-shell structures, uniform particle distribution, and also can sustain the release of drugs over 36 h. Furthermore, in vitro hemolysis, in vivo corneal irritation test, local allergenic test, and antifungal activity analyses are performed to evaluate the safety and efficiency of the formulations. Thus, good biosafety along with a significant anti-candidiasis effect are found in the NAT/CLZ@CTS/PLGA nanoparticles (NPs). Taken together, the results suggest that this design may provide a promising drug delivery system and a new option for the treatment of FK.

Preparation of Electro-Sprayed NPs

Various NP formulations were produced, including the single drug-loaded formulations (NAT@CTS/PLGA and CLZ@CTS/PLGA) and the co-loaded formulation NAT/CLZ@CTS/PLGA.

Zone of Inhibition Tests

The antifungal activity of electro-sprayed NPs was assessed against C. albicans by the zone of inhibition (ZOI) test (), which determined the level of antifungal activity that inhibits the growth of C. albicans. The NAT/CLZ@CTS/PLGA NPs were tested at a concentration of drugs equivalent to that of the NAT@CTS/PLGA NPs and CLZ@CTS/PLGA NPs. First, the C. albicans were co-cultured with sterilized SDB slants at 37°C and diluted with fresh medium to a concentration of 106 CFU/ml after 24 h of co-culture. Meanwhile, the sterilized SGA medium was poured into a disposable Nest culture plate and allowed to coagulate at room temperature (25 ± 1°C). The C. albicans (0.5 ml) were then evenly swabbed onto each plate and a 6-mm-diameter sterilized filter paper was then placed in the center of each culture plate. Then, an 8-μl sample of the NAT/CLZ@CTS/PLGA NPs was added to a fresh, sterilized 6-mm-diameter filter paper in a separate plate, and PBS (0.02 M, pH 7.4) was added as the negative control. To allow sufficient time for the fungi to grow and the formulations to diffuse, all the plates were placed in a low-temperature incubator (Shanghai Jinghong Experimental Equipment Co. LTD, SHP-150, China) at 37°C for 48 h. The potential antifungal activity was then presented as the diameter (mm) of ZOI.