Go to research.

Introduction

We determined the crystal structures of BhNiaR with apo and niacin-bound forms. A zinc ion was included in both the apo and niacin-bound models. The presence of the zinc was confirmed by an inductively coupled plasma mass spectrometer (ICP-MS). The structural data of BhNiaR provides details of metal binding and ligand interaction. DNA binding affinity of BhNiaR depending on niacin or metal ions was assessed by electrophoretic mobility shift assay (EMSA).

Model building and quality

The apo crystal structure of BhNiaR was refined to 2.0 Å resolution with crystallographic Rwork and Rfree values of 20.18% and 22.78%, respectively. Although the refined model contained a subunit in an asymmetric unit composed of 173 residues with a zinc ion and 129 water molecules, it could be generated to a homo-dimeric structure by a symmetric subunit. The N-terminal domain is composed of residues 7–70 and C-terminal domain is composed of residues 71–179. The N-terminal region (residues 1–6), the linker loop region (residues 68–74) connecting the N- and C-terminal domains, and the internal region (residues 137–147) in the C-terminal domain were poorly ordered due to lack of electron-density maps. The niacin-bound BhNiaR crystals were grown by co-crystallization with 2 mM niacin. The structure of the niacin-bound form was determined at 1.8 Å resolution and refined to crystallographic Rwork and Rfree of 19.43% and 24.26%, respectively. The refined model of niacin-bound BhNiaR also contained a subunit with interpretable residues 7–179 in an asymmetric unit. The N-terminus (residues 1–6), the linker loop region (residues 68–74), and the internal region (residues 137–145) in the C-terminal domain were poorly ordered. A niacin molecule was located near a zinc ion and surrounded by a hydrophobic pocket close to the dimeric interface. All refined models for BhNiaR indicated favored or allowed regions of the Ramachandran plot. The detailed refinement statistics are summarized in Table .

DNA binding affinity

To confirm the DNA-binding affinity of BhNiaR with its predicted cognate DNA segments, we performed EMSA using the type I DNA, 34-bp oligonucleotide (5′–CTCATTTACAT ATGTCTTGACATCTATATTTACA–3′) containing the nifS-nadB promoter region. The DNA was mixed with various amount of BhNiaR either in the absence or presence of niacin. BhNiaR bound to its cognate DNA with a dissociation constant (Kd) of ~ 0.5 µM in the presence of niacin, whereas the DNA-binding ability was decreased in the absence of niacin (Fig. a). BhNiaR moderately reduced DNA-binding to non-cognate sequences either with or without niacin (Fig. b). These results are consistent with homologous NiaR proteins from B. subtilis and T. maritima.

DNA binding affinity

To further assess whether the metal ion affects the DNA-binding affinity of BhNiaR, a BhNiaR H152A mutant was generated by site-directed mutagenesis resulting in metal-free BhNiaR, which was confirmed by an ICP-MS. The BhNiaR H152A mutant showed a severe defect in DNA-binding affinity regardless of the presence or absence of niacin (Fig. c). These results indicate that the metal ion, as well as niacin, plays an important role in DNA binding.

Conclusion

The crystal structures of the niacin-responsive repressor, BhNiaR, which negatively regulates the expression of genes involved in the NAD+ synthesis pathway, were determined to be the apo and niacin-bound forms. Our results show the coordination of a zinc ion and the binding of the effector molecule, niacin, in the NiaR structure. In the apo form, the zinc ion is coordinated by three residues (Glu91, His150, and His152) conserved in HPr-like proteins with a water molecule in tetrahedral geometry. Another conserved residue, His83, is not involved in zinc ion coordination but is involved in niacin binding. The niacin bound to the C-terminal domain of BhNiaR is located near a zinc ion, His83, and a well-conserved hydrophobic pocket. Both the niacin and the metal ion cooperatively affect DNA-binding affinity of BhNiaR, and the EMSA results show that the absence of a metal ion causes a significant defect in the DNA-binding affinity of BhNiaR.

Abstract

The probiotic Bacillus subtilis strain 29784 (Bs29784) has been shown to improve performance in broilers. In this study, we used a metabolomic and 16S rRNA gene sequencing approach to evaluate effects of Bs29874 in the broiler intestine. Nicotinic acid and hypoxanthine were key metabolites that were produced by the strain in vitro and were also found in vivo to be increased in small intestinal content of broilers fed Bs29784 as dietary additive. Both metabolites have well-described anti-inflammatory effects in the intestine. Furthermore, Bs29784 supplementation to the feed significantly altered the ileal microbiome of 13-day-old broilers, thereby increasing the abundance of genus Bacillus, while decreasing genera and OTUs belonging to the Lactobacillaceae and Enterobacteriacae families. Moreover, Bs29784 did not change the cecal microbial community structure, but specifically enriched members of the family Clostridiales VadinBB60, as well as the butyrate-producing families Ruminococcaceae and Lachnospiraceae. The abundance of various OTUs and genera belonging to these families was significantly associated with nicotinic acid levels in the cecum, suggesting a possible cross-feeding between B. subtilis strain 29784 and these beneficial microbes. Taken together, the data indicate that Bs29784 exerts its described probiotic effects through a combined action of its metabolites on both the host and its microbiome.

2.1. Bacterial Strain and Growth Conditions

Bs29784 is a commercially available probiotic for broilers (Alterion® NE, Adisseo, Commentry, France). The commercial product contains 1010 CFU/g spores of B. subtilis strain 29784 and is mixed at 1 g/kg in the feed that is supplied to broilers. For in vitro experiments, a pure culture of Bs29784 was obtained by inoculating the commercial probiotic in Luria–Bertani (LB) broth (Sigma-Aldrich, St. Louis, MO, USA). The bacteria were grown overnight at 37 °C under aerobic conditions. Bacteria were plated on LB plates and their identity was confirmed via matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS) [] and Sanger sequencing of the 16S region []. Bacterial growth was determined in LB broth over a 24-hour time span (grown in triplicate). Bacterial supernatant was obtained by centrifugation (5 min, 13,300 rpm) and filtered using a Polyvinylidene difluoride (PVDF) membrane filter (0.22 µm × 13 mm diameter, Kynar 500®, Arkema, Amsterdam, The Netherlands). Blank samples (medium without bacteria) were incubated simultaneously with the bacterial samples and processed in the same way to serve as controls. Samples were stored at −80 °C until metabolomic analysis.

2.2. Animal Trial

The study was undertaken following the guidelines of the ethics committee of the Faculty of Veterinary Medicine, Ghent University, in accordance with the EU Directive 2010/63/EU. One-day-old Ross 308 broiler chicks were obtained from a local hatchery and divided into 2 groups of 5 birds consisting of (1) a control group that received a standard commercial diet and (2) a group that received a standard commercial diet supplemented with the commercial Bs29784 probiotic at a dose of 1010 CFU/kg feed (FARM 1&2 mash, Versele-laga, Deinze, Belgium). Animals were housed on a solid floor covered with wood shavings at a density of 5 birds/m2. Animals were subjected to a light schedule of 12 h light and 12 h dark. All broilers were given water and feed ad libitum. At 13 days of age, all birds were weighed, the birds were euthanized, and digestive content from the jejunum, ileum and cecum was collected. These samples were frozen in liquid nitrogen directly after sampling and stored at −20 °C until further processing. The material from the 3 sections was used for metabolomic analysis and Bacillus quantification, while the ileal and cecal content was used for 16S sequencing. At 13 days of age, no differences in bodyweight could be observed, with an average bodyweight of 273.4 g ± 19.54 g (mean ± SD) for the control group and 254.3 g ± 38.37 g for the Bs29784-supplemented group (p = 0.358).